A3: AATGCCAATTCCATAGGATTAAATCGA

A4: AATGCCAATTCCATAGGATTAAATCGA

'So you see, entire segments of the DNA can be exactly the same. Four identical single-cell organisms.' She put down the sheet and picked up another. 'But instead we got this.'

Al: AATGCCA CGATGCTACCTG AAATCGA

A2: AATGCCA ATTCCATAGGATT AAATCGA

A3: AATGCCA GGAAATTACCCG AAATCGA

A4: AATGCCA TTTGGAACAAAT AATCGA

'Those are the base sequences of four amplicons from four of our jelly organisms. The DNA looks identical – until you hit brief hypervariable segments, where it all goes haywire. There's no pattern whatsoever. We've examined dozens of cells. Some differ only marginally in the hypervariable sections, but others are radically different. It can't be accounted for by the background mutation rate. In other words, the variations aren't coincidental.'

'Maybe this isn't a single species, after all,' said Anawak.

'No, it's definitely the same species. And there's definitely no way an organism can change its genetic coding in the course of its lifetime. The design plan comes first. Organisms are built according to their design plan, and once they're built, they correspond to that plan and no other.'

There was a long silence.

'But if, in spite of all that, the cells are still different,' said Anawak, 'they must have found a way of changing their DNA after they divided.'

'But for what purpose?' asked Delaware.

'A human purpose,' said Vanderbilt.

'Human?'

'Are you all deaf or something? Nature doesn't do this stuff. That's what Dr Oliviera said, and I haven't heard any objection from Dr Johanson. So who's got the nerve to cook this shit up? Those jelly cells are a biological weapon. Only humans could do a thing like this.'

'In that case, objection,' said Johanson. He ran his hand through his hair. 'It doesn't make sense, Jack. The advantage of biological weaponry is that you only need one recipe. Reproduction takes care of the rest.'

'But surely it's an advantage when a virus mutates. The AIDS virus is mutating all the time. Whenever we start to get wise to it, hey presto, it's changed its form.'

'That's different. We're dealing here with a superorganism, not a virological infection. There's got to be some other explanation as to why the cells are different. Something happens to their DNA after they divide. They're coded differently. Who cares what's responsible for making them do that? We need to find out why.'

'To kill us, of course,' Vanderbilt said angrily. 'The purpose of this gunk is to destroy the democratic world.'

'OK then,' growled Johanson, 'why don't you shoot it? I mean, maybe they're Islamic cells. Extremist DNA. That would make sense.'

Vanderbilt stared at him. 'Whose side are you on?'

'The side of understanding.'

'Well, I'm not sure I understand how you came to fall over last night.' Vanderbilt gave a smug smile. 'Maybe it had something to do with that bottle of Bordeaux… How are you feeling, Dr Johanson? Is your head OK? Maybe you should shut up and listen for a while.'

'Not if it means you doing all the talking.'

Vanderbilt wheezed. He was sweating profusely. Li shot him a scornful look from the corner of her eye and leaned forward. 'You say that they're coded differently, right?'

'Right.' Oliviera nodded.

I'm no scientist, but wouldn't it he possible that their coding serves the same purpose as any type of human code? Like military passwords, for instance.'

'Yes.' Oliviera nodded again. 'That would be possible.'

'Passwords that allow them to recognise each other.'

Weaver scribbled something on a scrap of paper and pushed it in Anawak's direction. He read it, gave a quick nod and laid it aside.

'Why would they need to recognise each other?' asked Rubin. 'And why use such an intricate method?'

'I'd have thought that was obvious,' said Crowe.

For a moment the only sound was the rustling of Cellophane as she unwrapped a pack of cigarettes.

'What do you mean?' asked Li.

'I'd say it's for communication,' said Crowe. 'The cells are communicating with each other. It's a kind of conversation.'

'You mean this stuff. . .' Greywolf stared at her.

Crowe held the lighter to the end of her cigarette, took a drag and exhaled. 'It's exchanging information.'

VEHICLE RAMP

'Whatever happened to you last night?' asked Oliviera, as they made their way down to the lab.

Johanson shrugged. 'I haven't the faintest idea.'

'And how are you feeling now?'

'A bit weird. The headache's getting better, but I've got a hole in my memory about the size of the hangar bay.'

'Bad luck, eh?' Rubin glanced back at them. His teeth showed as he smiled. 'Who'd have thought we'd both end up with a headache? What a pair of invalids. I felt so rotten last night that I couldn't even get out of bed to let you know what was wrong. I can't apologise enough. But when you feel a migraine coming on like that. . . Wham! It just hits you. I was out for the count.'

Oliviera fixed Rubin with an unfathomable look. 'A migraine, was it?'

'It comes and goes. It doesn't happen too often, but when I get one, there's nothing I can do. It's enough trouble just to swallow my tablets and turn out the lights.'

'And you didn't wake up until this morning?'

'Yeah.' Rubin looked at her guiltily. I'm sorry, but a migraine knocks me out. Normally I'd have at least popped down to the lab…'

'But you stayed in bed?'

Rubin gave her a vexed smile. 'Yes.'

'Are you sure?'

'Well, I should know.'

Something clicked in Johanson's head. It was like a broken projector: the carousel kept trying to drop a slide into position, but something was sticking.

They stopped in front of the door to the lab, and Rubin punched in the code. The door swung open. As Rubin walked inside and turned on the lights, Oliviera whispered to Johanson, 'What's up? You were the one who swore blind you'd seen him last night.'

Johanson stared at her. 'Was I?'

'You know,' murmured Oliviera. 'We were sitting on that crate, drinking wine and waiting for the sequencer to finish. You said you'd seen him.'

Click. The carousel tried to release the slide. Click.

His mind felt woolly. He could remember drinking a glass of wine. And they'd talked for a bit. And then he'd… He'd seen something?

Click.

Oliviera raised her eyebrows. 'My God,' she said. 'That must have been quite some blow to the head.'

NEURAL NETWORK COMPUTER

They were sitting in the JIC at Weaver's computer. 'OK,' she said. 'This stuff about the coding puts an entirely new spin on things.'

Anawak nodded. 'The cells aren't identical. They're not like neurons.'

'So it's not just a case of how they're connected. If their DNA contains individually coded sequences, maybe that's their secret. It could be how they aggregate.'

'No, there has to be another trigger – something that can work over distance.'

'Well, yesterday we were talking about scent.'

'OK,' said Anawak. 'Give it a go. Program the units so they can secrete a scent that tells them to aggregate.'

Weaver thought for a moment. She picked up the phone and used the intercom to dial the lab. 'Sigur? Hi. We're working on the computer simulation. Any new ideas about how these cells are aggregating?' She listened for a while. 'Fine. We'll try that… OK. Let me know.'

'What did he say?' asked Anawak.

'They're doing a phase test. They're trying to get the jelly to dissociate, then band back together.'

'So they agree that the cells could be using a scent?'

'Yes.' Weaver wrinkled her nose. 'The trouble is, which cell would secrete the scent first? And why? If it's a chain reaction, it has to start somewhere.'


Перейти на страницу:
Изменить размер шрифта: